> Sequence data read successfully
> Organism codon frequency file read successfully
> Mode selected: (g)ibson assembly
> Files & libraries read successfully
> ------------------------------------------
> Organism used is ecoliK12
> All sequences are OK (nt/AA)
> ====================================================================================
> Gibson Assembly operation starting...
> NOTE: For Gibson assembly, the sequence file should contain ONLY DNA sequences. The first sequence
	in the file should contain the 3' end of the backbone that the rest of the assembly is to connect
	to in 5'-3' order. The last sequence in the file should contain the 5' end of the backbone that the
	backend of the assembly should connect to in 5'-3' order.  Note the first and last sequence should
	be at least 100 nucleotides long so the algorithm can calculate the primer extensions.

	The middle sequences should include the fragments you want to assemble together.Each fragment should
	also be at minimum 50nt long

> IMPORTANT NOTE: DO NOT INCLUDE sequence homologies and overlaps in the assembly fragments, 
	these are auto-generated to optimize for uniformity of melting temperature. Keep in mind multiple
	fragment assemblies have a lower likelihood of success with more fragments.

	Each sequence should be on a separate line, blank newline entries in the file will result in a 
	read error.  The file should contain no other characters than the ones for a DNA sequence.  
	If your file is not formatted as such, please press [Ctrl]-C to stop the program and reformat your 
	file.
> ==========================================
> Melting Temperature: 50C
> Salt Concentration : 0.05M == 50.0mM
> ==========================================
> Front Backbone sequence 5'->3' (3' accessible): 150 nt long
	acaggctagcatataatcctgaggcgttaccccaatcgttcaccgtcggatttgctacagcccctgaacgctacatgtacgaaaccatgttatgtatgcactaggccaacaataggacgtagccttgtagttagtacgtagcctggtcgc
> Fragment 1: 118 nt long
	ataagtacagtagatcctccccgcgcatcctatttgcagatccgcagtggccggtagacacacgtccaccccgctgctctgtgacagggactaaagaggcgaagattatcgtgtgtgc
> Fragment 2: 130 nt long
	cccgttatggtcgagttcggtcagagcgtcattgcgagtagtcgtttgctttctcgaattccgagcgcgaacccacaaaacgtgatcgcagtccatgcgatcatacgcaagaaggaaggtccccatacac
> Fragment 3: 150 nt long
	cgacgcaccagtttacacgccgtatgcataaacgagctgcacaaacgagagtgcttgaactggacctctagttcctctacaaagaacaggttgacctgtcgcgaagttgccttgcctagatgcaatgtcggacgtattacttttgcctca
> Fragment 4: 115 nt long
	acagtaaccgccttttgaaggcgagtccttcgtctgtgactaactgtgccaaatcgtcttccaaactcctaatccagtttaactcaccaaattatagccatacagaccctaattt
> Rear Backbone sequence 5'->3' (5' accessible): 150 nt long
	cccgttatggtcgagttcggtcagagcgtcattgcgagtagtcgtttgctttctcgaattccgagcgattaagcgtgacagtcccagcgaacccacaaaacgtgatcgcagtccatgcgatcatacgcaagaaggaaggtccccatacac
> ==========================================
> Front Backbone + Fragment 1 overlap:
	['ctggtcgcataagtaca', 'ctggtcgc*ataagtaca', 49.961725601389674]
> Fragment 1 + Fragment 2 overlap:
	['agattatcgtgtgtgcc', 'agattatcgtgtgtgc*c', 49.961725601389674]
> Fragment 2 + Fragment 3 overlap:
	['gaaggtccccatacac', 'gaaggtccccatacac*', 50.715402071977906]
> Fragment 3 + Fragment 4 overlap:
	['ttgcctcaacagtaacc', 'ttgcctca*acagtaacc', 49.961725601389674]
> Fragment 4 + Rear Backbone overlap:
	['acagaccctaatttccc', 'acagaccctaattt*ccc', 49.961725601389674]
> ==========================================
> The following overlaps were determined between the fragments for optimizing T_m.
> They are listed in the format [overlap region, overlap with * marking junction, T_m of fragment.
	['ctggtcgcataagtaca', 'ctggtcgc*ataagtaca', 49.961725601389674]
	['agattatcgtgtgtgcc', 'agattatcgtgtgtgc*c', 49.961725601389674]
	['gaaggtccccatacac', 'gaaggtccccatacac*', 50.715402071977906]
	['ttgcctcaacagtaacc', 'ttgcctca*acagtaacc', 49.961725601389674]
	['acagaccctaatttccc', 'acagaccctaattt*ccc', 49.961725601389674]
> ==========================================
> Extending primer ends and determining reverse primer sequence...
> ==========================================
> Primers listed below are in 5'->3' direction.

> Front Backbone + Fragment 1 primers:
	Forward Primer (Tm = 48.8362354053 C):
		agattatcgtgtgtgccccgttatggtcgag
	Reverse Primer (Tm = 51.5695687386 C):
		ggcacacacgataatcttc
> Fragment 1 + Fragment 2 primers:
	Forward Primer (Tm = 50.850270493 C):
		ctggtcgcataagtacagtagatcctc
	Reverse Primer (Tm = 49.6171877863 C):
		tgtacttatgcgaccaggctacg
> Fragment 2 + Fragment 3 primers:
	Forward Primer (Tm = 48.8362354053 C):
		agattatcgtgtgtgccccgttatggtcgag
	Reverse Primer (Tm = 51.5695687386 C):
		ggcacacacgataatcttc
> Fragment 3 + Fragment 4 primers:
	Forward Primer (Tm = 50.715402072 C):
		gaaggtccccatacaccgacgcaccagtttac
	Reverse Primer (Tm = 50.715402072 C):
		gtgtatggggaccttc
> Fragment 4 + Rear Backbone primers:
	Forward Primer (Tm = 48.8362354053 C):
		acagaccctaatttcccgttatggtcgag
	Reverse Primer (Tm = 49.2917909609 C):
		gggaaattagggtctgtatgg
> ==========================================
> Temperature spread is : [48.8362354053, 51.5695687386]
> Temperature range is : 2.73333333333
> QuitFlush completed, Process Completed.